Skip to main content
Labitron
Menu
The intelligent lab workspace

Finally, a LIMS that works the way scientists actually think.

Labitron unifies your scientific notebook, sample tracking, sequence viewer, and analytics into one workspace — so your team stops switching tools and starts moving faster.

Cloud-hosted with on-prem option · 30-min walkthrough · No slides — we open the product.

Experiment · ELN-2026-0421
Protocol · qPCR primer screen

Anneal at 60 °C, extend 30 s

Linked sample SAM-1247 · primer P_TP53_F

160
ATGGCAGAGCCCAGGCCTGTACGAGTTCCACCGTCGAAGGCATCTGAACG
CDS primer
SampleCqΔCqResult
SAM-124722.4−1.8pass
SAM-124823.1−1.1pass
SAM-124928.6+4.4review

One workspace. One source of truth. From sample to sequence to result.

The pain we replace

Stop switching tools. Start moving faster.

Modern labs are forced to juggle a LIMS, an ELN, spreadsheets, and a desktop sequence viewer. Labitron replaces all four with one connected workspace.

"Our LIMS is rigid and our team avoids it."

A flexible block editor — adapts to any workflow

Protocols, experiments, SOPs, project notes — all linked, all searchable, all built in the same Notion-style editor your team already enjoys using.

"We export to Excel, R, and IGV every day."

Built-in analytics + native sequence viewer

Gigabyte-scale CSVs open in seconds. Statistics built in. DNA and RNA visualized in context — no more bouncing between tools to look at a plasmid map.

"Compliance is a quarterly fire drill."

Audit trails, e-signatures, RBAC — built in

21 CFR Part 11-ready signatures, immutable timestamps on every record, role-based access on every object. Compliance is the byproduct, not the project.

"AI is everywhere except where my data lives."

An AI assistant that's already read everything

Natural-language search across pages, samples, inventory, and datasets. Summarize protocols. Draft methods sections. Flag QC anomalies as data lands.

At a glance

Built for the way modern labs actually work.

1 workspace
ELN, LIMS, sequence viewer, and analytics — together
GB-scale
datasets open in seconds in the virtualized data grid
FASTA / GenBank
native import; linear and circular sequence views
21 CFR Part 11
electronic signatures + immutable audit trails

Trusted by lab teams

Coming soon — early-access partners onboarding now.

Logo
Logo
Logo
Logo
Logo
Logo

Compliance & standards

Built for the regulations your lab actually answers to.

21 CFR Part 11
e-signatures
ISO 17025
testing labs
ISO 27001
information security
GxP-ready
GLP / GMP audit trails
HIPAA
PHI handling
GDPR
EU data residency

Cloud-hosted with on-prem option for enterprise. See the trust page →

Get started

Ready to give your lab one workspace?

Walk through Labitron with our team and see how it would fit your setup.